menu
Qamnty
Answers by Timur Mustafaev
Login
Register
My account
Edit my Profile
Private messages
My favorites
Answers by Timur Mustafaev
Ask a Question
Questions
Unanswered
Tags
Ask a Question
Answers by Timur Mustafaev
Filter
User Timur Mustafaev
Recent activity
All questions
All answers
○Medial lemniscal pathway / dorsal column in Primary sensory neuron has
answered
Nov 9, 2024
Medicine
college
3
votes
84.0k
views
Find the radius of a circle with a circumference of 4/5 pi.
answered
Oct 29, 2024
Mathematics
college
5
votes
143k
views
What regulates and controls the development of the land and buildings within the applicable municipal boundaries?
answered
Oct 19, 2024
Law
college
4
votes
77.4k
views
Max was overwhelmed with his college coursework and decided to reduce his course load from 6 to 5 classes in the fall express this change as a percent
answered
Sep 22, 2024
Mathematics
high-school
7
votes
123k
views
How to run astral ii on command line
answered
Aug 29, 2024
Computers & Tech
high-school
4
votes
103k
views
{2, 4, 4, 6, 9} mean = 5 You add one number to this set. Which number would change the mean the most? O 20 O 1 O 5
answered
Aug 17, 2024
Mathematics
college
5
votes
225k
views
Carlos was born into a Spanish-speaking household and as an infant he made many babbling sounds that could be identified as Chinese or Swahili, in addition to those that sounded Spanish. Now, as an adult,
answered
Jun 26, 2024
Social Studies
high-school
5
votes
44.0k
views
What's the purpose of a counterargument paragraph? To introduce a main point that proves your thesis To give the opposing argument equal space in your paper To address an opposing argument and refute it
answered
Feb 2, 2024
English
college
4
votes
217k
views
Identify the altele(s) in this stretch of DNA. The top fragment is from the paternal chromosome and the bottom fragment is from the maternal chromosome. GCAATCAGTCAGTCAGTTATCGGG GCAATCAGTCAGTCAGTCAGTCAGTTATCGGG
answered
Jan 26, 2024
Biology
high-school
1
vote
234k
views
Dr. David Smith lived 1/13 of his life as a child. He spent 4/39 of his life preparing for an outstanding medical career. For 1/ 2 of his life, he was a successful surgeon in a famous children's hospital.
answered
Nov 30, 2023
Mathematics
high-school
1
vote
39.6k
views
Which of the following cases would be least likely to result in a manager creating an exception in a company's dress code. A. Sam wants to wear jeans to work because he finds dress pants uncomfortable.
answered
May 8, 2023
Business
high-school
9
votes
223k
views
roger Scored 18 goals for his soccer team for the 2019 season. during games one and two, he scored 3 goals each game. How many goals did he average in the remaining games if he played in a total of 8 games?
answered
Feb 19, 2023
Mathematics
college
0
votes
156k
views
Why does steam at 100°c give severe burn than water at 100 c?
answered
Dec 8, 2022
Physics
high-school
6
votes
96.5k
views
What is X equal to in this problem?
answered
Nov 11, 2022
Mathematics
high-school
1
vote
125k
views
Point B of a triangle ABC is at (4,5). If triangle ABC is reflected about the x-axis and then translated 3 units to the right, what are the new coordinates of B?
answered
Sep 12, 2022
Mathematics
middle-school
5
votes
161k
views
Which is the equation of a line with a slope of -2 and passes through the point of (3,-4)
answered
Aug 19, 2022
Mathematics
high-school
3
votes
230k
views
A turtle is 1.5 feet long. If there were 6 of these turtles standing in a line, what would the length of the line be in yards?
answered
Jul 5, 2022
Mathematics
high-school
7
votes
347
views
PLEASE HELP ME!! SO HARD
answered
Jun 13, 2022
Mathematics
high-school
6
votes
25.8k
views
How many minutes will it take to plate out 2.19 g of chromium metal from a solution of Cr3+ using a current of 35.2 amps in an electrolyte cell ?
answered
Apr 11, 2022
Chemistry
college
4
votes
136k
views
Which statement best describes the size of the Mayan civilization? 40 cities and 20 million people 20 cities and 40 million people 40 cities and 10 million people O It was the size of Spain.
answered
Dec 20, 2021
Social Studies
college
7
votes
199k
views
Page:
1
2
3
next »
Ask a Question
Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.
Search Qamnty