Recent activity by Timur Mustafaev

Question

A medium sized car typically weighs 1000kg. Gravity force = 9.8 N/Kg A hydraulic system to jack the care up above an inspection pit has for slave cylinders whose pistons have a cross section area of 0.

asked Nov 22, 2024

1 answer 222k views

Dallas: "Bikini's on Miscle Beach". Like to see some muscle? *he props his feet next to her* / 1. Yes 2. No

asked Nov 14, 2024

1 answer 215k views

○Medial lemniscal pathway / dorsal column in Primary sensory neuron has

answered Nov 9, 2024

1 answer 84.0k views

Find the radius of a circle with a circumference of 4/5 pi.

answered Oct 29, 2024

1 answer 143k views

What regulates and controls the development of the land and buildings within the applicable municipal boundaries?

answered Oct 19, 2024

1 answer 77.4k views

3. What is the angle of rotation of the following figure? 180° 60° 90° 45°

asked Sep 25, 2024

2 answers 85.0k views

Max was overwhelmed with his college coursework and decided to reduce his course load from 6 to 5 classes in the fall express this change as a percent

answered Sep 22, 2024

1 answer 123k views

How to run astral ii on command line

answered Aug 29, 2024

2 answers 103k views

{2, 4, 4, 6, 9} mean = 5 You add one number to this set. Which number would change the mean the most? O 20 O 1 O 5

answered Aug 17, 2024

1 answer 225k views

Carlos was born into a Spanish-speaking household and as an infant he made many babbling sounds that could be identified as Chinese or Swahili, in addition to those that sounded Spanish. Now, as an adult,

answered Jun 26, 2024

1 answer 44.0k views

if there's 2,003 snakes currently and there's a constant rate of 100 per year what would be the equation for the population

asked Jun 15, 2024

1 answer 32.8k views

Why might topical, cosmetic application of atropine or scopolamine from the belladonna plant not cause fatal poisoning, as would occur with ingestion of the plant?

asked May 28, 2024

1 answer 97.7k views

Consider the partially completed one-way ANOVA summary table below. In conducting the test whether all the population means are equal, all of the below assumptions must hold except the populations follow.

asked Apr 4, 2024

1 answer 42.9k views

Which term can be used in the blank of 3662−222 so the greatest common factor of the resulting polynomial is 2? a. 12 b. 18 c. 24 d. 36

asked Feb 23, 2024

1 answer 186k views

What's the purpose of a counterargument paragraph? To introduce a main point that proves your thesis To give the opposing argument equal space in your paper To address an opposing argument and refute it

answered Feb 2, 2024

1 answer 217k views

Identify the altele(s) in this stretch of DNA. The top fragment is from the paternal chromosome and the bottom fragment is from the maternal chromosome. GCAATCAGTCAGTCAGTTATCGGG GCAATCAGTCAGTCAGTCAGTCAGTTATCGGG

answered Jan 26, 2024

1 answer 234k views

Dr. David Smith lived 1/13 of his life as a child. He spent 4/39 of his life preparing for an outstanding medical career. For 1/ 2 of his life, he was a successful surgeon in a famous children's hospital.

answered Nov 30, 2023

1 answer 39.6k views

Two stores are having sales on the same shirt. the sale at store 1 is "2 shirts for $22" and the sale at store 2 is "each $12.99 shirt is 10% off". explain how much will you save by buying at store 1.

asked Sep 21, 2023

2 answers 125k views

A car dealer will sell you a used car for $6,298 with $798 down and payments of $168.51 per month for 48 months. What is the simple interest rate? (Round your answer to the nearest tenth of a percent.)

asked Sep 4, 2023

1 answer 198k views

Madison has a round garden. The diameter is 14 feet. What is the area of the garden? use π = 3.14.

asked Jun 4, 2023

1 answer 203k views

Ask a Question