Recent activity by Thdoan

Question

Choose all that are true. A rhombus is a : A. Trapezoid B. Quadrilateral C. Rectangle D. Parallelogram E. Square I thought square since a square is a rhombus and a quadrilateral since it is one I think.

asked Dec 15, 2024

1 answer 66.5k views

Task A₁ Slack Duration (days) Аз A4 A5 What is the slack for activity A2 ? 12 593m co 8 days

asked Sep 24, 2024

1 answer 68.6k views

What is the setting in the story rock, ghost, willow, deer

asked Sep 22, 2024

1 answer 218k views

In a qualitative fit test, a challenge agent is used outside the respirator to see if the wearer of the respirator can detect it. One of the agents used is ____________. a) Strawberry scent b) Banana oil

asked Aug 26, 2024

1 answer 165k views

Using your H-W equation, calculate the following. The value of q is 0.28; there is then a value to p2; what does the information tell us about this answer? Question options: Heterozygous individuals are

answered Aug 22, 2024

1 answer 24.8k views

Which is not specifically targeted for destruction by the proteasome?

asked Aug 20, 2024

1 answer 6.3k views

After the licensee has been notified, a disciplinary hearing can be held even if:____

answered Aug 16, 2024

1 answer 18.3k views

Calculate the melting temperature of teh following DNA fragments using the sequences only: A. AGTCTGGGACGGCGCGGCAATCGCA B. TCAGACCCTGCCGCGCCGTTAGCGT C. TCAAAAATCGAATATTTGCTTATCTA D. AGTTTTTAGCTTATAAACGAATAGAT

asked Jun 8, 2024

1 answer 206k views

Explain ONE positive health effect likely to result from improved access to electricity in urban areas.

asked May 16, 2024

1 answer 146k views

Find a vector b such that the solution set of Ax=b is not a line parallel to the solution set of Ay=b.

answered May 14, 2024

1 answer 57.8k views

a rectangular box mailing box has a length in inches of x+5, width of x+1, and a height twice as long as its width. What is the volume of the box in cubic inches?

asked Apr 26, 2024

2 answers 215k views

L1.3.3 Quiz: Understand Deeper Contextual Themes Question 4 of 10 Which theme is most typical of a creation story? A. A traveler takes a long, dangerous journey. B. Curiosity leads to the loss of something

asked Apr 13, 2024

1 answer 74.9k views

Using examples, explain the importance of Cnidarians to the marine ecosystem?

answered Mar 25, 2024

1 answer 115k views

How to tell activity pattern (nocturnal/diurnal), diet, and locomotion from skeletal evidence

asked Feb 7, 2024

1 answer 184k views

Discuss two examples of stabilizing natural selection, using butterflies and goldenrod flies.

asked Feb 4, 2024

1 answer 211k views

*26) Allscott Company is developing its budgets for 2016 and for the first time, will use the kaizen approach. The initial 2016 income statement, based on static data from 2015, is as follows:* Sales (140,

answered Jan 18, 2024

1 answer 124k views

Consider this expression. m² - 7 + n² When m = -2and n = 5, the value of the expression is

answered Dec 15, 2023

1 answer 225k views

When marcus started school at 5 years old, his parents put $9,050 into a college fund account that earned 7.5% interest. what is the total amount in the account when he starts college at 18 years old?

answered Aug 31, 2023

1 answer 21.4k views

Why did President Kennedy start the Alliance for Progress program? to provide military aid to allies in Europe to improve relations with the Soviet Union to promote economic development in Africa to prevent

asked Jul 22, 2023

1 answer 234k views

Helppppppppppppp plsssssssssssssssss

answered Jul 19, 2023

1 answer 22.1k views

Ask a Question