menu
Qamnty
Answers by Tim McClure
Login
Register
My account
Edit my Profile
Private messages
My favorites
Answers by Tim McClure
Ask a Question
Questions
Unanswered
Tags
Ask a Question
Answers by Tim McClure
Filter
User Tim McClure
Recent activity
All questions
All answers
Important and useful way to annotate an entire section of text is to _____.
answered
Dec 23, 2024
English
college
2
votes
212k
views
Using the order of operations, what should be done first to evaluate (-2) + 4- (-15 * 9/3) - 42? a. Add -15 and 9. b. Divide 4 by -15. c. Subtract 4 from 3. d. Multiply 9 by 3.
answered
Nov 27, 2024
Chemistry
high-school
3
votes
116k
views
calculate the ph of a solution that is made by combining 55 ml of 0.040 m hydrofluoric acid with 125 ml of 0.100 m sodium fluoride.
answered
Oct 29, 2024
Chemistry
high-school
4
votes
64.3k
views
Show that (1 . 0) + (1 . 0)= 1
answered
May 6, 2024
Mathematics
college
3
votes
160k
views
Find a8 of the geometric sequence if it's first term is 6 and second term is 30.
answered
Apr 30, 2024
Mathematics
high-school
4
votes
168k
views
I need to know how to find the measure of angle QRS from this diagram.
answered
Jun 14, 2023
Mathematics
college
3
votes
187k
views
8. A circular lid has an area of 50.24 square centimeters. What is the radius of the lid? Use 3.14 for T. A.4 cm B. 8 cm C 12 cm D. 16 cm
answered
May 27, 2023
Mathematics
high-school
6
votes
91.2k
views
Х 24, 36, 48 y -8, 1, 10 What is the y-intercept of the line?
answered
Apr 6, 2023
Mathematics
high-school
7
votes
139k
views
January 2, 2018, Cullumber, Inc. purchased a patent for a new consumer product for $810000. At the time of purchase, the patent was valid for 15 years; however, the patent’s useful life was estimated to
answered
Nov 27, 2022
Business
college
4
votes
53.1k
views
Would you expect someone to receive a chastisement for performing a generous act? Explain your answer, based on the meaning of chastisement in The Tragedy of Julius Caesar, Act IV
answered
Nov 1, 2022
English
college
4
votes
143k
views
Help please ! order the side lengths GH , HI , IG from least to greatest
answered
Oct 22, 2022
Mathematics
college
4
votes
159k
views
A cube shaped box has a side of length 10mm.What is the volume of the box?
answered
Jul 17, 2022
Mathematics
high-school
4
votes
103k
views
1011 0110 10102 = ?16
answered
Jun 24, 2022
Computers & Tech
college
3
votes
85.0k
views
If sin(3x)= cos(x+6), what is value of x
answered
May 30, 2022
Mathematics
college
5
votes
148k
views
Kuroo cursed me -_- 3 to the power of 8
answered
May 25, 2022
English
high-school
10
votes
199k
views
Which sentence is written correctly with a conjunctive adverb? Select one: I really wanted the red one; however I bought the blue one. I really wanted the red one, I bought the blue one. I really wanted
answered
May 13, 2022
English
college
2
votes
37.9k
views
Tiktaalik is an example of a transitional form linking __________ to ancestral __________.
answered
Mar 11, 2022
Biology
high-school
2
votes
223k
views
The Guarantee Clause gives the legislature the power to make all necessary and proper laws. true of false
answered
Feb 17, 2022
Social Studies
high-school
10
votes
43.0k
views
Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 8C. If an RNA duplex oligonucleotide of
answered
Nov 7, 2021
Biology
college
5
votes
227k
views
This is the rule for how much fabric she needs to buy. • Measure from your waist to the finished length of the pants • Double this measurement • Add 8 inches 1. Amy's measurement from her waist to the
answered
Jul 19, 2021
Mathematics
high-school
0
votes
97.3k
views
Page:
1
2
3
next »
Ask a Question
Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.
Search Qamnty