Recent activity by RTOSkit

Recent activity by RTOSkit

alex has $10 and begins saving $6 each week toward buying a nee phone. at the time that alex begins saving, sarah has $70 and begins saving $3 per week on supplies for her art class. when will alex and

asked Dec 20, 2024

1 answer 188k views

CALL PANEL: Pressing and holding the MECH pushbutton does what? A) Initiates a mechanical system check B) Activates the passenger call system C) Opens the main cabin door D) Notifies the flight attendants

asked Dec 9, 2024

1 answer 87.8k views

What would be the sequence of an RNA produced by using the DNA sequence shown below as a template? 3′ TACCGTGCGTGACATTAAGCC 5′". Write the sequence from 5′ to 3′, left to right

answered Nov 2, 2024

1 answer 198k views

The blastocyst divides into two sections of cells before implanting itself into the uterine wall. What are these two sections called?

asked Oct 15, 2024

1 answer 3.9k views

During gamete formation in a horse, how many chromosome pairs of a cell duplicate? a) 32 b) 46 c) 64 d) 128

answered Sep 9, 2024

2 answers 177k views

What kind of markings indicates parking spaces for disabled citizens?

answered Aug 1, 2024

1 answer 113k views

Why would you need to put an ellipsis at the beginning or end of a quote?

asked Jun 9, 2024

2 answers 30.2k views

In third person objective point of view, the author is a) biased b) unbiased c) subjective d) a character in the story

asked May 16, 2024

1 answer 151k views

How does and digital camera work

answered May 3, 2024

2 answers 149k views

How to find an equation of a line on a graph

asked Apr 21, 2024

2 answers 139k views

Which skater, if either, has the greater speed after the push-off? a. Skater A, who is heavier b. Skater B, who is lighter c. Both have the same speed d. It cannot be determined from the given information

answered Apr 12, 2024

1 answer 135k views

The age of revolution. how wan an American colony governed? why were the colonists resentful ?

answered Mar 13, 2024

1 answer 116k views

Consider this hypothetical reaction: a 4b c 3d. assume that the equation is balanced. which mole ratio will produce the most product? question 15 options: 3a/4b 4a/b a/b a/4b

asked Mar 9, 2024

1 answer 100k views

Personal databases are designed to support a small group of individuals working together on a project. a) True b) False

asked Mar 7, 2024

1 answer 162k views

Write a single output statement that outputs the following three lines: He said, "How is that possible?" She replied, "Using manipulators." "Of course!" he exclaimed.

asked Jan 8, 2024

1 answer 132k views

Businesses can defer Feature Updates for up to a maximum of how many days?

asked Jan 6, 2024

1 answer 40.8k views

Hi can someone help me answer this question pleaseee 1. Why are the two dialogue bubbles on the bottom right hand of page 82 overlapping? (story: Anya's ghost)

asked Dec 7, 2023

1 answer 89.9k views

Let f(x) = - 5x + 6. Find and simplify f(3a-5).f(3a –5)=(Simplify your answer.)

asked Oct 23, 2023

1 answer 207k views

Urgent need of assistance

asked Oct 16, 2023

1 answer 75.0k views

Please help it is due today Simplify (4³)⁵ (I am not asking anyone to solve it, I am only asking for it to be simplified) A. 12⁵ B. 4⁸ C. (1/4) ¹⁵ D. 4¹⁵

asked Aug 26, 2023

1 answer 207k views

Search Qamnty