Recent activity by Nicholas Trandem

Recent activity by Nicholas Trandem

Which statement best describes the Chinese who immigrated to the United States in the late1800s? OA. Many Chinese immigrant workers entered th OB. Chinese immigrants integrated into American O c. Many

asked Dec 3, 2024

1 answer 84.9k views

Gabriela walks to the pizza place for lunch. he walk 1 km east, then 1km south and then 1km east again. what distance did he cover? what was his displacement

answered Dec 2, 2024

1 answer 160k views

A ballet created by Jean-Baptiste Lully, in which the first female dancers appeared.

answered Nov 15, 2024

2 answers 63.0k views

Identify the subject in this sentence: Maya Angelou is a famous writer. Maya Angelou famous writer is

asked Oct 1, 2024

1 answer 45.5k views

Enroute to Cancun the flight diverts to Houston because of bad fish sandwiches. Is a new release required prior to departing Houston?

answered Sep 15, 2024

1 answer 204k views

Tina is cutting out snickerdoodle cookies with a circular cutter. The cutter has a radius of 19 millimeters. What is the cutter's circumference? Use 3.14 for л. If necessary, round your answer to the nearest

answered Sep 8, 2024

2 answers 190k views

Type the correct answer in each box. Express your answer to four significant figures. The temperature of 15.71 grams of gold rises from 32°C to 1,064°C, and then the gold melts completely. If gold’s specific

asked Jul 18, 2024

1 answer 144k views

For each rhombus, find each angle measure or segment length.

asked Jun 19, 2024

1 answer 80.6k views

Using swap space significantly _________ system performance. a) increases b) decreases c) maintains d) does not affect

answered Apr 30, 2024

1 answer 63.6k views

What are the responsibilities of the watch chief (WC)? Select all that apply. a.The WC plans, coordinates, and controls fire support for the commander. b.The WC is in charge of the daily battle tracking

answered Apr 11, 2024

1 answer 214k views

A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated

asked Apr 1, 2024

1 answer 186k views

Find the value of mx -1 is a factor of 8 x* +4x3 - 16x +10x + m.

answered Mar 27, 2024

2 answers 223k views

Why the stamp act created a much larger, more angry response than sugar act?

answered Mar 10, 2024

1 answer 90.6k views

In the 1800s empires in the Middle East, India, Africa, and China had A. Unified peacefully under one ruler B. Successfully resisted Western imperialism C. Experienced colonization and exploitation by

answered Feb 14, 2024

1 answer 88.9k views

Some objects with four wheels are cars. All cars posses a steering wheel. This object has four wheels but no steering wheel. Therefore: a. this object is a car b. this object is not a car c. this object

answered Feb 10, 2024

1 answer 65.3k views

Find the probability that a point chosen lies in the shaded region. Express your answer as a fraction. A. 4/5 B.9/12 C. 54/45 D. 1/8

asked Feb 8, 2024

1 answer 4.3k views

If you listen to Rap Music What 2021 Artist do you like

answered Dec 6, 2023

2 answers 52.3k views

What new business strategies allowed businesses to weaken or eliminate competition?.

answered Aug 24, 2023

2 answers 43.8k views

If √(x^2+2y+4) +√(x^2+x-y+5)=√(x^2+x+3y+2) +√(x^2+2x+3) x+y=?

asked Jul 11, 2023

1 answer 88.4k views

Need help with my Spanish assignment

answered Jul 10, 2023

2 answers 20.0k views

Search Qamnty