Recent activity by Kitae

Recent activity by Kitae

Opposite of the noun phrase a trivial affair

asked Nov 17, 2024

1 answer 23.2k views

What would happen to a fish with red blood cells in the really cold waters of the Antarctic?

answered Sep 21, 2024

1 answer 42.9k views

What are the catheter sizes for adult males (Fr)?

asked Sep 18, 2024

1 answer 188k views

Find the amino acid chain that forms from the mRNA sequence DNA sequence below. GATCGATACCATTCGGCGCATACTTCG

answered Sep 10, 2024

1 answer 99.2k views

Find the missing side of each triangle

answered Aug 23, 2024

1 answer 210k views

An acceptable method to construct a foundation on expansive soil would be?

answered Jul 20, 2024

1 answer 114k views

Two cables are attached to an old telephone pole at right angles to each other. Each is pulled with a force of 5000 N. What is the net force on the pole exerted by the two cables?

answered Jul 15, 2024

1 answer 6.1k views

Suppose there is a constant friction in the bearings of the axle. a. Would this tend to make your experimental value of the axle, (I_A), too small or too large? b. If the friction drag is unchanged for

asked Jun 26, 2024

1 answer 139k views

BlueSkies Inc., a regional airline based in Des Moines, decided to go nationwide, open at least two reservation counters in every U.S. city with a population over 800,000, and create a Web site where customers

asked May 17, 2024

1 answer 233k views

Used Consider the following function. f(x)=x−2sin(x) Find f′(x) f′(x)= For what values of x does the graph of f have a horizontal tangent? (Use n as your integer variable. Enter your answers as a comma-separated

answered May 15, 2024

1 answer 87.2k views

A triangle has a base that measures 6.4 feet. Its height measures 5 feet. How many square feet is the area of the triangle?

asked May 14, 2024

1 answer 157k views

Solve the compound inequality: ""4m < -44 OR m - 9 > 19."" Please provide a full explanation of the solution.

asked May 6, 2024

1 answer 110k views

Solve and explain question

asked Apr 19, 2024

1 answer 10.3k views

Section 2 8. Which of these nutrients is sometimes associated with high blood pressure? a. sodium c. iron b. calcium d. carbohydrate

answered Apr 17, 2024

1 answer 20.2k views

Describe the possible reasons for Greeks to colonize in the Archaic period.

answered Mar 17, 2024

1 answer 49.5k views

An apartment complex manager is replacing some of the appliances . He bought 3 ovens and 4 refrigerators for $4583. Each oven cost $570 less than a refrigerator. What is the cost of one oven

asked Mar 7, 2024

1 answer 141k views

Find the volume of the solid enclosed by the paraboloid z=2+x²+(y−2)² and the planes z=1,x=1, x=−1,y=0, and y=4

asked Jan 23, 2024

1 answer 85.3k views

Why might one African tribe enslave members from another tribe

asked Dec 21, 2023

1 answer 58.5k views

What are rational irrational numbers? give examples

answered Dec 11, 2023

2 answers 233k views

What SAS stand for in math?

answered Sep 18, 2023

1 answer 60.0k views

Search Qamnty