Recent activity by Kirill Vashilo

Question

What is the most current hypothesis for how the moon was formed?

answered Dec 27, 2024

1 answer 200k views

Fundamentalist Islamic governments in the Middle East often use advanced technologies for a variety of purposes. True False

answered Dec 10, 2024

1 answer 222k views

A balanced die is tossed twice. Let X and Y denote the smaller and larger of the two faces. Find the joint probability mass function (PMF) of X and Y.

answered Nov 3, 2024

1 answer 152k views

11 of 20 What is the Order of Operations in Sheets?

asked Oct 25, 2024

1 answer 39.6k views

Based on Hooke's law, when is stress proportional to strain? A) Until the elastic limit B) Beyond the yield point C) In the plastic deformation region D) At the ultimate tensile strength

answered Oct 9, 2024

1 answer 216k views

You changed the style set in the current document that has several styles applied to text. You will notice text with styles applied changed in appearance with respect to paragraph formatting or _____ formatting

asked Oct 3, 2024

1 answer 180k views

Use the Chain Rule to find the indicated partial derivatives for the following functions: z = x^4 + x^2y, x = s + 2t - u, y = stu^2 1. ∂z/∂s 2. ∂z/∂t 3. ∂z/∂u Evaluate when s = 3, t = 2, u = 1

answered Sep 15, 2024

1 answer 67.3k views

In a pulley system, pulley A is moving at 1600 rpm and has a diameter of 15 inches. Three pulleys, B, C, and D, all of different sizes, are attached to a simple output axle. Speed and torque are changed

asked Aug 16, 2024

1 answer 122k views

It is very important for consumers enrolling in a CSNP to know the following about accessing providers: a) Members are never charged more when seeing out-of-network providers. b) Members can see any Medicare

asked Aug 1, 2024

1 answer 134k views

Determine the density of a sample of an unknown substance that has a volume of 5 cm3 and a mass of 20 grams. (round to the nearest hundredths place)

asked Jul 15, 2024

1 answer 221k views

With each cycle, a vacuum pump removes 25% of the air in a glass container. What percent of the air has been removed after 10 cycles?

asked Jul 5, 2024

1 answer 69.4k views

Which of the following statements applies to the classification concept of "Revealed by"? a) Documenting actual behavior or choices b) Predicting future trends c) Identifying theoretical concepts d) Analyzing

answered Apr 10, 2024

1 answer 235k views

What color is you’re favorite and why green or pink pink because it’s light and a pretty color and green is dule

asked Apr 8, 2024

1 answer 200k views

According to the Florida statue, how many times was a teacher allowed to paddle a student? 20 10 5 15

answered Apr 7, 2024

1 answer 189k views

in an experiment to measure the value of pi, the following results are obtained for p 3.14 3.11 3.20 3.06 3.08 Calculate the: Standard Deviation of the Mean. 00491 0/1pts Question 10 In an experiment to

answered Jan 26, 2024

1 answer 84.7k views

Write out the sequence of amino acids that make up the protein from the following mRNA strand AUGGCUGGAUGGCUCUCGACUUAGAAAUGA

asked Jan 20, 2024

1 answer 154k views

write a statement that calls print larger, passing it sales and sales, as the first and second arguments, respectively

asked Nov 11, 2023

1 answer 111k views

Why do people feel obligated to follow traditional practices

asked Oct 2, 2023

1 answer 26.5k views

Classify each of the following lines as parallel, transversal or perpendicular.

answered Sep 8, 2023

1 answer 50.2k views

Solve the logarithmic equation. Be sure to reject any value that is not in the domain of the original logarithmic expression. Give the exact answer.

asked Sep 4, 2023

1 answer 26.9k views

Ask a Question