Recent activity by Ken De Guzman

Question

A bag of M&M candies has 2 colors in it. The colors are green and red to a ratio of 2:3 (that is, for every 2 green candies there are 3 red candies). You open the bag and find 14 green candies. a) How

asked Dec 15, 2024

1 answer 81.9k views

Is 1s²2s²2p⁶ the symbol for a macroscopic property or a microscopic property of an element? Explain your answer. a) Macroscopic b) Microscopic c) Both d) Neither

asked Dec 10, 2024

1 answer 129k views

Please answer this question - Semester about to end :'). Ty

answered Oct 16, 2024

1 answer 83.6k views

Mary Parker Company paid $15,000 to acquire 3,000 shares of ABC Corporation common stock. Mary Parker's journal entry to reocrd this transaction would include a: a. Credit to retained earnings b. credit

asked Oct 14, 2024

1 answer 159k views

(a) The pupils in 6th class have a book to read for school. So far Niamh has read 4/9 the book, Oliver has read 5/8, Amelia has read 7/12and Jack has 4/10 read toWho has read (i) the greatest number of

answered Oct 9, 2024

1 answer 110k views

1. Using the line of nucleic bases provided complete the complimentary DNA base pair strand? TATCGAGCCGTATGACGATGAACGAATTCCTAA 2. How many base pairings did you make? 3. Using the line of DNA nucleic bases

answered Sep 28, 2024

1 answer 104k views

21 point paragraph explaining how I used algebra over the weekend

asked Aug 19, 2024

1 answer 146k views

Choose the correct form of the future tense. Después de la fiesta, ustedes________ cansados. O estará O O estarán estaremos

answered Aug 12, 2024

1 answer 62.1k views

At your gym, the bar you lift weighs 45 pounds. You add weights to the bar that are 10 pounds each. If you add 6 weights to the bar, how many pounds will you lift?

answered Jul 30, 2024

2 answers 119k views

To declare a constraint that an employee is only male or female, we use _________ Select one: a. Attribute-based CHECK constraint b. Not-null constraint c. Referenced integrity constraint d. Tuple-based

answered Jul 16, 2024

1 answer 93.9k views

Solve Time dependent Schrodinger equation and observe the propagation of wave packet as animation in a potential barrier in Python (or Jupyter notebook). Steps: 1. Define x- domain and the step potential

answered Jul 13, 2024

1 answer 29.9k views

The nurse is analyzing the fecal characteristics of a patient. Which substances indicate an abnormality? Select all that apply.

answered Jul 10, 2024

1 answer 41.7k views

Jenny started working for Williams Equipment on June 20, 2008. She worked Monday to Friday, and was paid weekly on Fridays. She is due to have a baby on August 29, current year. Prior to starting her maternity

asked May 8, 2024

1 answer 190k views

The center of gravity method does not take into consideration

answered Mar 29, 2024

2 answers 146k views

#NAME?

answered Mar 24, 2024

1 answer 228k views

Fill in the blanks by selecting the correct option below. Fractures cause sharp pain that increases with movement. Carefully monitor and the peripheral vascular circulation to the injury. Mobility; pr

answered Mar 10, 2024

1 answer 30.8k views

Helppppppppppppppppppp

asked Feb 8, 2024

2 answers 88.4k views

After completing the fraction division 5 divided by 5/3, Miko used the multiplication shown to check her work. 3x5/3=3/1x5/3=15/3 or 5

asked Dec 6, 2023

1 answer 220k views

Which expression is equivalent to 3(x+5)+2x

answered Nov 1, 2023

2 answers 180k views

WHAT IS CELLULAR COMPONENTS CHARACTERISATION

answered Sep 22, 2023

1 answer 37.5k views

Ask a Question