Recent activity by Dodgrile

Recent activity by Dodgrile

Who was the main opponent of the Greek city-states in the Persian Wars? a. Rome b. Persia c. Carthage d. Egypt

answered Dec 23, 2024

2 answers 55.3k views

Which rhetorical device does the author use to emphasize and reinforce the point that women are as good as men? a) Allusion b) Dialogue c) Personification d) Repetition

asked Dec 5, 2024

1 answer 81.7k views

___ is defined as the production of a substance by the coming together of chemical elements, groups, of simpler compounds or by the degradation of a complex compound where simple molecules are built larger

answered Dec 4, 2024

1 answer 30.6k views

The following sequence was taken from a DNA molecule: 5'- AACCTTTAGGGCCCTTTAAA - 3'. Given that the temperature required breaking one bond in the molecule is 12°C. What is the total temperature required

answered Oct 5, 2024

1 answer 126k views

What is the value of x in the equation (x + 40)? a) 0 b) 20 c) 35 d) 70

answered Sep 21, 2024

1 answer 61.6k views

What is the latest reasearch on insomnia

answered Jul 29, 2024

1 answer 20.1k views

What is the gist of the Bayesian approach?

answered Jul 16, 2024

1 answer 4.5k views

What do you anticipate to be some of the biggest challenges in pursuing a career as a PA?

answered Jun 25, 2024

1 answer 126k views

How does wave 1 differ from wave 4? 1) Wave 4 has a higher frequency than wave 1. 2) Wave 1 has a higher amplitude than wave 4. 3) Wave 1 has a higher frequency than wave 4. 4) Wave 1 has a smaller wavelength

asked Jun 6, 2024

1 answer 172k views

Deoxyribonucleotides (DNA) use which Pentose?

asked Mar 26, 2024

1 answer 230k views

Jose and his children went into a grocery store where they sell apples for $2.25 each and mangos for $1.25 each. Jose has $20 to spend and must buy at least 9 apples and mangos altogether. Also, he must

answered Mar 10, 2024

2 answers 10.1k views

Assume that X is normally distributed with a mean m = $64. If P(X ³ $75) = 0.2981, then the standard deviation of X is approximately equal to

asked Feb 27, 2024

1 answer 4.7k views

Which of these testing methods is often used in industry certification exams? 1) Unit testing 2) Integration testing 3) System testing 4) All of the above

answered Feb 7, 2024

2 answers 155k views

In a recent survey of students who graduated from a large public high school, nine out of ten students reported that they passed biology with a grade of seventy-five percent or higher. What further data

asked Jan 20, 2024

1 answer 204k views

Which mineral property is shown below demonstrated by mica? a) Luster b) Cleavage c) Hardness d) Fracture

asked Jan 20, 2024

1 answer 152k views

An infection develops in the body before any signs or symptoms appear during its _____ period.

asked Jan 17, 2024

1 answer 201k views

If s is the specific heat capacity of 4kg water, what is the specific heat capacity of 16kg water? a) 2s (b) s/2 (c) s (d) 4s

answered Dec 13, 2023

1 answer 48.3k views

A ceiling fan can rotate 150.59 times per minute. The fan rotated a total of 3,764.75 times. Which of the following is true? A. The fan rotated for 26 minutes. B. The fan rotated for 24 minutes. C. The

answered Sep 30, 2023

2 answers 59.8k views

T 1 ¿Cómo puedo llegar al cine? Promero 2 ¿Cómo puedo llegar al café? Primero 3 ¿Cómo puedo llegar a la biblioteca? Prime

answered Sep 19, 2023

2 answers 165k views

Please Help i need a professional no scam answers that have been happening i need to get allot done bye friday

answered Aug 8, 2023

1 answer 151k views

Search Qamnty