Recent activity by David Bentley

Recent activity by David Bentley

Actor-model raquel welch died at 82. which movie did she win a golden globe for?

answered Dec 22, 2024

1 answer 156k views

If a woman who has a mass of 115 lb, what is her mass in grams?

asked Oct 22, 2024

1 answer 146k views

What other books did Cooper write that have the same perspective as The Pilot?

asked Sep 20, 2024

1 answer 135k views

Helppppppppppppppppppppppppppp

answered Sep 15, 2024

2 answers 37.9k views

How much of a radioactive kind of bismuth will be left after 40 minutes if you start with 72 grams and the half-life is 20 minutes? a) 9 grams b) 18 grams c) 36 grams d) 45 grams

asked Sep 11, 2024

1 answer 17.0k views

Physiologic jaundice of a newborn is due to deficiency of what enzyme? a) Glucuronyl transferase b) Biliverdin reductase c) Uridine diphosphate-glucuronyl transferase d) Heme oxygenase

asked Aug 13, 2024

1 answer 196k views

A construction company takes 1 7/8 hours to remove 3 1/2 metric tons of dirt from a construction site. What is the unit rate in metric tons per hour? Write your answer as a fraction or a mixed number in

asked Aug 6, 2024

1 answer 182k views

Conflicts of interest exist when an attorney or paralegal moves from __________.

asked May 12, 2024

1 answer 1.0k views

give three characteristic or traits of the anglo saxon hero and explain how beowulf shows each of these traits throughout the novel

answered Apr 15, 2024

1 answer 30.0k views

TACAGGATCATTTCGCGAACGGAGCCGAACT 1. Convert this DNA to Pre mRNA, mRNA, and tRNA

asked Apr 13, 2024

1 answer 3.7k views

A supervisor must certify timecards for their employees no later than close of business on:

answered Apr 11, 2024

1 answer 86.1k views

The behavioral science approach to management has its roots in techniques created for American and British military personnel and equipment in World War II. True or False?

asked Mar 13, 2024

1 answer 193k views

If a patient's initial presentation makes you suspicious about a particular respiratory condition, what should you do? 1) Confirm your suspicions with a thorough assessment 2) Immediately perform a focused

asked Feb 16, 2024

1 answer 176k views

Whenever the marginal cost exceeds the average cost, the average cost will rise with another unit of output. Whenever the marginal cost is less than the average cost, the average cost will fall with

asked Feb 15, 2024

1 answer 154k views

arsenic is a toxic solid often used in the past as a component of pesticides. how many electrons are present in a neutral atom of arsenic?

asked Feb 7, 2024

1 answer 120k views

give an ionic equation to represent the neutralisation reaction between sodium hydroxide and surphuric acid

asked Jan 12, 2024

1 answer 176k views

Which regions have populations with 9 as the power?

asked Oct 1, 2023

2 answers 103k views

What's the distance between 3/4 and 1/8 on a number line?

answered Sep 1, 2023

1 answer 82.8k views

A standard solution of sodium carbonate was prepared by dissolving 10.6 g of the anhydrous salt in distilled water. The solution was then transferred to a standard flask and the total volume was adjusted

answered Aug 16, 2023

1 answer 152k views

Divit earned $1,420 each month for 3 months this summer working as a lifeguard he spent $450 on a new bike and put half of the rest of his earnings in a savings account?

asked May 28, 2023

1 answer 174k views

Search Qamnty