Recent activity by Chris Miles

Recent activity by Chris Miles

Always foreseeable intervening forces (defendant is liable)

answered Jan 3

1 answer 76.9k views

Fill in the chart with your knowledge of the atom's parts. Particle Location Charge Symbol Proton Options: a) +1 nucleus yes p b) +1 nucleus no p c) -1 nucleus yes p d) -1 nucleus no p

asked Nov 20, 2024

1 answer 13.4k views

1.United Nations Organisation 2.United Nations Organisation specialized agencies

asked Sep 20, 2024

1 answer 152k views

1. What is the sequence of amino acids that would be made from the following DNA template sequence as a result of transcription and translation? AGGCTATTGCATCCCTTGAGA

answered Sep 15, 2024

1 answer 51.8k views

Which expression represents the product of ³ + 2x - 1 and 24-2³ +3? 27-22¹-3 x¹2x² + x¹ + 2x³ + 6x − 3 27-2+2r³-32¹ +42³ +62-3 ¹ + 2x + 2

asked Aug 28, 2024

1 answer 143k views

There are 105 different plants at a botanical garden. Of these, 31 will flower in the spring. What percent of plants will not flower in the spring? Give an estimate for the answer and describe how the

answered Jul 29, 2024

1 answer 164k views

Which is the most important in interpreting past environments from layers of sedimentary rocks?

asked Jun 28, 2024

1 answer 8.6k views

To change the FCAW filler metal diameter to the next size up, would this require a NEW WPS or WPS REQUALIFICATION? A) New WPS B) WPS Requalification

answered Jun 19, 2024

1 answer 19.9k views

Piccadiliy Pizza bought a used Ford delivery van on January 2, 2021, for $19,200. The van was expected to remain in service for four years (71,200 miles). At the end of its useful life, Piccadilly management

asked May 21, 2024

1 answer 51.5k views

Please help me and give me all 3 of the answers i dont need an expalanation or anything just the answers this is due in 25 minutes.

asked Apr 3, 2024

1 answer 208k views

What accounting entries are required to be made by AK Ltd to properly account for the amount received from BN Ltd?

answered Mar 30, 2024

1 answer 108k views

All levels of Hazwoper emergency responders must have refresher training or demonstrate competency at least ________________.

asked Mar 3, 2024

1 answer 206k views

1 Which shape is pictured above? O A. cylinder OB. cube OC. rectangular prism OD. sphere All rights reserved. Reset Next

asked Feb 24, 2024

2 answers 163k views

•An Airman cannot reenlist in their current Air Force specialty code (AFSC) if a Career Job Reservation (CJR) has not been approved by how many months prior to their date of separation (DOS)?

asked Feb 17, 2024

1 answer 11.5k views

Skydiving - Parachute canopies are usually made from nylon fabric that lasts for thousands of jumps - whether the skydiver does or not.

answered Jan 29, 2024

1 answer 111k views

Which action should you never see a lifeguard do while on duty? A) Actively scanning the pool area B) Talking to swimmers C) Checking pool water quality D) Sitting in a lifeguard chair

asked Jan 4, 2024

1 answer 39.5k views

What does it mean to describe evolution as a scientific theory?.

asked Dec 15, 2023

1 answer 167k views

DUE IN A FEW MIN PLEASE HELP!!! SO CONFUSED! IM RUNNING OUT OF TIME AND DONT HAVE THE TIME TO TRY AND FIGURE IT OUT! PLEASE HELP! QUESTION DOWN BELOW!

answered Nov 1, 2023

1 answer 42.8k views

crossing over occurs when chromosomes overlap and portions of the chromosome swap places. Mistakes during crossing over can lead to?? choose all that apply ! PART A:A. part of the chroma zone is broken

asked Oct 10, 2023

1 answer 234k views

Convert into power notation (-2197)

answered Jul 24, 2023

1 answer 204k views

Search Qamnty