Recent activity by Calvin

Question

Explain two influences on whether demand for a product is price elastic or price inelastic

answered Dec 28, 2024

1 answer 166k views

Which of the following adults is most likely to increase his or her physical activity? A. Someone with a sedentary lifestyle B. Someone with chronic health issues C. Someone with a busy work schedule D.

asked Nov 5, 2024

1 answer 24.9k views

These two short sequence reads from two different recombinant plasmids overlap to form a contig. How long (in bp) is this contig? Write the number only. Seq#1: CGCGTAGGGACTCTCTAGAAGGG Seq#2: GTAAGGGCGCATATATCCCTTCTAGA

asked Oct 27, 2024

1 answer 99.0k views

When salary and interest allowances allocated as distribution of profits exceed the net profit, a loss has occurred. a. True b. False

answered Oct 16, 2024

1 answer 201k views

Amy is six years older than her brother Leo. Leo is seven years old. If Maths equation stands for Amy’s age, which of these sentences could be used to find her age?

asked Oct 2, 2024

1 answer 7.6k views

In how many different ways can the first, second and third prize winners be selected from a group of 8 people running a race? [assume that there are no ties]. A. 8! / 5! B. 8! / (5! × 3!) C. 8! D. 38 E.

answered Sep 8, 2024

1 answer 57.5k views

What is the primary purpose of a cricothyrotomy or coniotomy procedure? A) To treat a dental emergency B) To perform a tracheostomy C) To access the carotid artery D) To address a fracture in the larynx

asked Aug 27, 2024

1 answer 55.0k views

Johnson's Medicare program provided medical benefits to: a. the unemployed b. all Americans c. the elderly d. single mothers and their children e. the handicapped

asked Aug 8, 2024

1 answer 129k views

2/3 (n - 6) = 5n - 43 please help me i cant get the right answer you will get 30 points please help

answered Jun 16, 2024

1 answer 85.4k views

Distinguish the appearance of Staphylococci spp. on Mannitol Salt Agar

asked Jun 15, 2024

1 answer 199k views

At a certain factory, the daily output is Q(L) 60,000L13 units, where L denotes the size of the labor force measured in worker-hours. Currently 1,000 worker-hours of labor are used each day. Estimate the

asked Apr 16, 2024

1 answer 234k views

What would happen if the intracellular domain of a cell-surface receptor was switched with the domain from another receptor? a) The receptor would lose its ability to bind ligands b) The receptor would

asked Mar 18, 2024

1 answer 230k views

A blue-colored salamander breeds with a yellow-colored salamander of the same species, and the resulting babies are green-colored. this is an example of: a. mitosis b. plete dominance c. epistasis d. incomplete

answered Feb 2, 2024

1 answer 46.7k views

= What is the perimeter of the thangle ? 2m 2m 2m

answered Jan 28, 2024

1 answer 26.0k views

When a surface always appears as a foreshortened surface (never as a line) on the six regular places of a projection, it is classified as? 1) Orthographic projection 2) Isometric projection 3) Oblique

answered Jan 24, 2024

1 answer 36.5k views

Five runners need to be arranged in 5 lanes for a race so that there is a runner in each lane How many unique ways are there to arrange the numbers in the 5 lanes

answered Jan 21, 2024

1 answer 97.2k views

Why did Islam spread more widely in Indonesia than in India?

answered Dec 29, 2023

2 answers 225k views

What is the important factor in the eradication of the social problem? Write any one factor

asked Nov 8, 2023

1 answer 209k views

QUESTION 10 ST lies on the coordinate plane with S located at (3,2). The midpoint of ST is Z at (3,5). Where is endpoint T located? OA. (3, 3.5) OB. (3, 8) C. (3, 7) OD. Not enough information.

asked Oct 23, 2023

1 answer 159k views

A bowling ball and a Ping-Pong ball are rolling at the same speed. Which ball requires more force to stop

answered Sep 6, 2023

1 answer 133k views

Ask a Question