menu
Qamnty
Questions by Bdimag
Login
Register
My account
Edit my Profile
Private messages
My favorites
Questions by Bdimag
Ask a Question
Questions
Unanswered
Tags
Ask a Question
Questions by Bdimag
Filter
User Bdimag
Recent activity
All questions
All answers
As a forensic scientist, you are given the task of identifying an unknown substance found at a crime scene. Which method do you think would provide more reliable results - a flame test or the emission
asked
Dec 4, 2024
Social Studies
high-school
1
answer
5
votes
202k
views
True or False? The difference between a court of equity and a court of law is a court of equity awards relief in the form of action such as issuing an injunction, while a court of law orders money damages
asked
Dec 1, 2024
Law
college
1
answer
1
vote
177k
views
Simplify the equation (-x⁴+20x²-19x+12)/(x-4).
asked
Nov 16, 2024
Mathematics
high-school
1
answer
5
votes
99.8k
views
Which of the following is a reason why third parties are relatively weak in the United States? Third party candidates must collect a large number of signatures to appear on the ballot in an election. O
asked
Oct 10, 2024
Social Studies
college
1
answer
0
votes
34.1k
views
How do you solve for lim(x→0) cos(5/x)? a) The limit does not exist. b) The limit is 0. c) The limit is 1. d) The limit is undefined.
asked
Jun 5, 2024
Mathematics
high-school
1
answer
1
vote
20.7k
views
What structure is attached to the valcular cusps and prevent valves from swinging back into the atria A. papillary muscle B. myocardial cords C. chordae tendinea D. auricular tissue
asked
Apr 7, 2024
Biology
high-school
1
answer
3
votes
74.9k
views
The Brown family bought 3 hotdogs and 2 bags of chips and spent $7.50. The Riley family bought 6 hotdogs and 5 bags of chips and spent $15.75. Find the price of one hotdog and one bag of chips.
asked
Feb 24, 2024
Mathematics
high-school
1
answer
1
vote
218k
views
What do these two changes have in common? Rust forming on a bicycle frame, baking cookies A) Corrosion involved B) Both are irreversible changes C) Heat is released D) Unrelated
asked
Feb 22, 2024
Health
high-school
1
answer
5
votes
133k
views
How do structural and enzyme virulence factors contribute to the success of bacterial infections, and can you provide examples to illustrate their roles?
asked
Jan 23, 2024
Biology
high-school
1
answer
2
votes
70.1k
views
Find the exponential Fourier series coefficients of the following signals and plot their amplitude and phase spectra. Note that no integration is needed to solve the problem. (a) x₁ (t)=2+4cos(3πt)−2jsin(7πt)
asked
Jan 4, 2024
Mathematics
college
1
answer
2
votes
86.9k
views
If the concentration of mercury in the water of a polluted lake is 0.200 μg (micrograms) per liter of water, what is the total mass of mercury in the lake, in kilograms, if the lake has a surface area
asked
Dec 10, 2023
Chemistry
college
1
answer
1
vote
184k
views
Two jets leave an air base at the same time and travel in opposite directions. One jet travels 86 mi/h slower than the other. If the two jets are 2696 miles apart after 2 hours, what is the rate of each
asked
Oct 3, 2023
Mathematics
high-school
1
answer
4
votes
222k
views
Which set of numbers could represent the lengths of the sides of a right triangle? 7, 9, 11 12, 18, 22 10, 15, 20 8, 15, 17
asked
Jul 25, 2023
Mathematics
high-school
1
answer
3
votes
67.9k
views
How did the Enabling Act of 1933 affect politics in Germany?
asked
Jun 3, 2023
History
college
1
answer
6
votes
206k
views
6n−8(n+4)= what? Please help me
asked
May 3, 2023
Mathematics
college
2
answers
3
votes
117k
views
A 196 mL sample of a gas at 36°C and 864 torr is heated to 76°C and the pressure is allowed to drop to 400 torr. What volume will the gas occupy at these new conditions? Answer in units of mL. PLEASE HELP
asked
Oct 9, 2022
Chemistry
high-school
1
answer
2
votes
47.4k
views
Suppose you created a set of instruments using water and drinking glasses. You need a note with a very low pitch to complete a certain song—what should you do? Pour out some of the water in the glass with
asked
Sep 9, 2022
English
college
1
answer
0
votes
119k
views
1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids:
asked
Jun 27, 2022
Biology
high-school
2
answers
20
votes
93.6k
views
M + 7 ≥ 20, if m = 11
asked
Jun 25, 2022
Mathematics
high-school
1
answer
5
votes
146k
views
9. Write an application that computes and displays the day on which you become (or became) 10,000 days old. Save the application as Ten ThousandDaysOld.java. TI
asked
May 21, 2022
Computers & Tech
high-school
2
answers
12
votes
135k
views
Page:
1
2
3
next »
Ask a Question
Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.
Search Qamnty