Recent activity by Autobyte

Recent activity by Autobyte

The District of Columbia law requires that the driver and _____________ wear seat belts.

answered Dec 16, 2024

1 answer 211k views

Which is one factor of rock types that affects the rate of weathering? porosity moisture temperature mineral color

asked Nov 17, 2024

1 answer 182k views

show that the set of whole numbers is not closed under division by finding two whole numbers whose quotient is not a whole number.

answered Nov 16, 2024

1 answer 158k views

Why must zeotropic refrigerant leave the cylinder as a liquid?

asked Nov 5, 2024

1 answer 222k views

Triangles ABC and TUV are similar. The length of the sides of ABC are 40, 50, and 24. The length of the longest side of TUV is 275. Using what you have learned about similar triangles, find the perimeter

asked Oct 11, 2024

1 answer 221k views

How would southern states, like South Carolina, most likely respond to Henry Clay's American System?

answered Oct 8, 2024

2 answers 69.8k views

The modified duration of a bond portfolio worth $175 million is 4.625 years. By approximately how much does the value of the portfolio change, if all yields increase by 25 basis points? a. Decrease $2,

answered Sep 29, 2024

1 answer 144k views

________ tends to take a long time, even several years, while ________ therapy is relatively brief.

asked Sep 19, 2024

1 answer 49.3k views

So my question is in the title : Why can s and p orbitals of one atom form hybrid orbitals but the overlapping of one s orbital and one p orbital (perpendicular to the bond axis) of two different atoms

asked Aug 25, 2024

1 answer 8.7k views

Which of the following will have same number of molecules at STP. A)280cm^3 of CO2 and 280cm^3 of N2O. B)44g of CO2 and 11.2dm3 CO C)11.2dm^3 of O2 and 32g of O2 D)28g of N2 and 5.6dm^3 of oxygen

asked Aug 22, 2024

1 answer 205k views

Which of the following rules about turning is FALSE? 1) When making turns, go from one lane to the other as directly as possible without crossing lane lines. 2) Where there are no signs to control turning,

answered Aug 7, 2024

1 answer 130k views

It is entirely possible to have a member of the Dark Triad as _________.

asked Jul 25, 2024

1 answer 69.7k views

Find the distance between the points (4,9) and (0,6).

asked Jul 6, 2024

1 answer 88.8k views

How do you tell if a sentence is a thesis statement?

answered May 15, 2024

1 answer 105k views

TACAGGATCATTTCGCGAACGGAGCCGAACT 1. Convert this DNA to Pre mRNA, mRNA, and tRNA

answered Apr 19, 2024

1 answer 3.7k views

the nurse is preparing a child for the insertion of an intravenous line. the child is fearful and crying. which intervention by the nurse is the best family-centered, developmentally appropriate approach

asked Feb 21, 2024

1 answer 53.4k views

How do you solve this problem what is A divided by A% of A

answered Sep 8, 2023

1 answer 93.5k views

O EQUATIONS AND INEQUALITIESTranslating a sentence into a one-step equationTranslate this sentence into an equation.The product of 5 and Helena's score is 95.Use the variable 2 to represent Helena's score.

asked Aug 27, 2023

1 answer 83.1k views

(PLEASE HELP!) Annie wishes to build a set of five stairs according to the plan below. (a) How high is each step? (b) How wide is each step, correct to 2 decimal places?

answered Aug 19, 2023

1 answer 90.4k views

What is the slope of a line that is perpendicular to y=4/5x+15 and passes through point (-3,4)?

answered Jul 11, 2023

1 answer 161k views

Search Qamnty