asked 154k views
5 votes
Transcribe and translate the following strand.

CGTACGGGCAGGATCGGCGAACTGGA
Transcription: 1
(The answer for transcription must be in all caps; example: AAAAAAA)
Translation:
(The answer for translation must be in the following format: first letter capitalized and each amino
acid separated by a hyphen; example: Met-Met-Met-Met)
Second Base of mRNA Codon
С
A
G
UUU Phe
UUC Phe
UUA Leu
UUG Leu
UCU Ser
UCC Ser
UCA Ser
UCG Ser
UAU Tyr UGU Cys
UAC Тут UGC Cys
С
UAA STOPUGA STOPA
UAG STOP UGG Trp
CUU LCI
CUC Leu
CỦA LcU
CƯ Leu
CCU Pro
CCC Pro
CCA Pro
CCG Pro
CAU His
CAC His
CAA Gln
CAG Gln
CGU Ang
CGC Arg
CGA Arg
CGG Arg
First Base of mRNA Codon
Third Base of mRNA Codon
AUU Te
AUC le
AUA Ile
AUG Met
ACU Thr
ACC Thr
ACA Thr
ACG Thr
AAU Asn
AAC Asn
AAA Lys
AAG Lys
AGU Ser
AGC Ser
AGA Arg
AGG Arg
G
GUU Val
GUC Val
GUA Val
GUG Val
GCU Ala
GCC Ala
GCA Ala
GCG Ala
GAU Asp
GAC Asp
GAA Glu
GAG Glu
GGU Gly
GGC Gly
GGA Gly
GGG Gly
Pon-90A​

asked
User Alex DG
by
8.8k points

1 Answer

3 votes

Answer:

AAC Asn

AAA Lys

AAG Lys

AGU Ser

AGC Ser

AGA Arg

AGG Arg

G

GUU Val

GUC Val

GUA Val

GUG Val

GCU Ala

G

answered
User Tesserex
by
7.8k points

Related questions

asked Jun 17, 2024 76.8k views
Anders Arpi asked Jun 17, 2024
by Anders Arpi
8.2k points
1 answer
1 vote
76.8k views
asked Oct 15, 2019 77.5k views
Blazer asked Oct 15, 2019
by Blazer
8.1k points
2 answers
5 votes
77.5k views
Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.