asked 205k views
1 vote
Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

2 Answers

3 votes
The answer is DNA I know because I know
answered
User Soloidx
by
7.5k points
2 votes

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

No related questions found

Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.