Register

What is the mRNA that would be transcribed from this strand of DNA?

What is the mRNA that would be transcribed from this strand of DNA?
asked 214k views
5 votes
What is the mRNA that would be transcribed from this strand of DNA?

What is the mRNA that would be transcribed from this strand of DNA?-example-1
asked
User KovBal
by
8.3k points

1 Answer

6 votes

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Step-by-step explanation:

answered
User Leonardo Wildt
by
8.4k points
← Prev Question Next Question →

Related questions

User Sudhir Kumar
asked Aug 18, 2024 152k views
Where does the mRNA strand go once it has been transcribed?
Sudhir Kumar asked Aug 18, 2024
by Sudhir Kumar
8.1k points
1 answer
3 votes
152k views
Ask a Question
Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.

Categories

Other Questions

Which of the objects is living or nonliving: Bacteria, virus, moss, you, a lemon seed, the air, bread, lettuce and rocks?
Why aren't all minerals gemstones?
What are three important types of forces
Link Copied!