0 Comments
Answer:
TAGCTTTAAAGCGTCGATGCT
Step-by-step explanation:
A AND T are complimentary and G and C for DNA