Question

Type your response in the box. The sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the other strand be? Start with the top of the strand and work down

Answer 1

TAAGCCGATAAATGCTAACGGTA

Step-by-step explanation:

Just had it on a quiz, got it right.

Answer 2

The correct answer is- TAAGCCGATAAATGCTAACGGTA.

Step-by-step explanation:

DNA is a nucleic acid molecule made of two strands. Each strand is made up of nucleotide bonded via phosphodiester bonds. Each nucleotide is made up of- 5C deoxyribose sugar, a phosphate group and nitrogenous bases.

DNA replication produces an exact copy of the DNA molecule through complementary base pairing. The complementary strand is formed by adding nucleotide through DNA polymerase which adds base pairs according to the Chargaff rule. The Chargaff rule states that A will bind T via two hydrogen bonds and G will bind C via three hydrogen bonds.

Therefore, the complementary strand will be-TAAGCCGATAAATGCTAACGGTA