menu
Qamnty
Questions by Updogliu
Login
Register
My account
Edit my Profile
Private messages
My favorites
Questions by Updogliu
Ask a Question
Questions
Unanswered
Tags
Ask a Question
Questions by Updogliu
Filter
User Updogliu
Recent activity
All questions
All answers
The process that takes place when organic compounds are broken down in the absence of oxygen is_______? A- respiration B- oxidation C- transpiration D- fermentation
asked
Jul 12, 2018
Biology
high-school
1
answer
3
votes
235k
views
What is 30 m/s northwest, an example of
asked
Jul 11, 2018
Physics
high-school
1
answer
4
votes
209k
views
The Supreme Court ruled that the ____________________ was unconstitutional. a. Tariff system c. slavery b. American System d. all of the above Please select the best answer from the choices provided A
asked
Jul 4, 2018
History
middle-school
2
answers
4
votes
27.9k
views
Kohler and lipton first discovered a growth factor (pdgf) by:
asked
Jun 24, 2018
Biology
high-school
1
answer
3
votes
203k
views
What is an example of plagiarism
asked
Dec 17, 2017
English
high-school
2
answers
3
votes
116k
views
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3')?
asked
Oct 7, 2017
Biology
college
1
answer
0
votes
26.5k
views
Which of the following is not a type of speech Shakespeare uses to develop character
asked
Aug 28, 2017
English
high-school
2
answers
4
votes
190k
views
Page:
« prev
1
2
3
Ask a Question
Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.
Search Qamnty