menu
Qamnty
Answers by Submartingale
Login
Register
My account
Edit my Profile
Private messages
My favorites
Answers by Submartingale
Ask a Question
Questions
Unanswered
Tags
Ask a Question
Answers by Submartingale
Filter
User Submartingale
Recent activity
All questions
All answers
What are the coventional representative of automation
answered
Feb 8, 2022
Engineering
college
4
votes
85.6k
views
In ΔRST, the measure of ∠T=90°, TR = 1.8 feet, and RS = 8.7 feet. Find the measure of ∠S to the nearest tenth of a degree.
answered
Jan 31, 2022
Mathematics
college
5
votes
169k
views
What is the tightening and relaxing of the uterus
answered
Jan 29, 2022
Health
college
7
votes
130k
views
John has $55 . He buys 6 books. Each book costs the same amount. He now has $10 . Drag expressions to complete the tape diagram shown to model this situation.
answered
Jan 12, 2022
Mathematics
high-school
2
votes
200k
views
Question 10 Which of the choices below is an irrational number?
answered
Dec 15, 2021
Mathematics
high-school
4
votes
209k
views
N the United States, why was the South slower to industrialize than the North? It had an agricultural economy that was dependent on enslaved persons. It was still recovering from the Civil War. It had
answered
Dec 8, 2021
History
high-school
5
votes
214k
views
Solve the equation. 3/4x+3-2x=-1/4+1/2x+5
answered
Nov 30, 2021
Mathematics
high-school
1
vote
62.3k
views
Joseph's highest level of education is an associate's degree. For which position might he be verified? A. Software Developer B. Web Designer C. Network Support Specialist D. Network Architect
answered
Oct 11, 2021
Computers & Tech
high-school
1
vote
119k
views
Put the prefixes kilo, milli, micro, and centi in order from largest to smallest
answered
Oct 3, 2021
Biology
high-school
2
votes
90.5k
views
Which health conditions can occur with a mineral deficiency? A Abnormal cell growth and dehydration. B Osteoporosis and fatigue. с Strong muscles and poor brain development. D Alzheimer's and cancer.
answered
Aug 26, 2021
Health
college
3
votes
136k
views
How were Jewish people viewed during the Holocaust?
answered
May 31, 2021
History
middle-school
3
votes
170k
views
I need help :( please
answered
Apr 25, 2021
Mathematics
high-school
5
votes
111k
views
True or False: There can be more than one strong beat in a measure.
answered
Apr 21, 2021
Arts
college
5
votes
15.4k
views
The directions on a seed packet say to plant the seeds 1 7/8 inches apart. What is the decimal equivalent of this mixed number?
answered
Mar 14, 2021
Mathematics
high-school
0
votes
93.6k
views
Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3' 3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG
answered
Mar 8, 2021
Biology
college
6
votes
132k
views
What is the value of x: 5x + 4 = 2x +22 How would you solve this question?
answered
Feb 26, 2021
Mathematics
middle-school
3
votes
12.3k
views
Suppose a rumor is spreading that eating pickles will raise a person's IQ. Assume that 80 people have heard the rumor as of today and each day the number of people (past and present) who have heard
answered
Feb 8, 2021
Mathematics
college
3
votes
180k
views
What is the meaning of resin and where can u use it ?
answered
Jan 13, 2021
Chemistry
middle-school
5
votes
187k
views
This goes with my last question I really just cannot understand this for the life of me
answered
Jul 26, 2020
French
middle-school
1
vote
132k
views
Consider the table. Types of Bacteria Form Shape Associated disease Coccus X Strep throat Bacillus Rod shaped Y Spirillum Spiral Cholera Which best describes X and Y? X = Spherical; Y = E. coli X = Comma
answered
Jan 13, 2020
Biology
high-school
0
votes
40.0k
views
Page:
« prev
1
2
3
next »
Ask a Question
Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.
Search Qamnty