menu
Qamnty
Questions by Rolfy
Login
Register
My account
Edit my Profile
Private messages
My favorites
Questions by Rolfy
Ask a Question
Questions
Unanswered
Tags
Ask a Question
Questions by Rolfy
Filter
User Rolfy
Recent activity
All questions
All answers
Evaluate: [7(5 – 2) + 42] ÷ 9
asked
Dec 25, 2021
Mathematics
college
1
answer
1
vote
195k
views
Help with this question
asked
Dec 12, 2021
Mathematics
college
1
answer
2
votes
162k
views
35. The normal body temperature is 98 °F. Aris has the flu and his temperature is 102 10°F. How many degrees above normal is his body temperature?
asked
Dec 1, 2021
Mathematics
college
1
answer
2
votes
54.3k
views
PLEASE HELP! A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine the DNA segments from two different species: Species A: GTACCTAAGTTCACCGAATT
asked
Sep 13, 2021
Biology
high-school
1
answer
5
votes
86.2k
views
Solution to the equation 4x + 3 = 3 + 4x
asked
Jul 9, 2021
Mathematics
college
2
answers
4
votes
92.9k
views
Help please!! I really need help, I’m failing French and don’t know how to do any of these:(
asked
Jun 10, 2021
French
high-school
1
answer
1
vote
230k
views
HELP ME PLEASE!!!!!!!!!!4(a+2)=8+4a
asked
Mar 9, 2021
Mathematics
college
2
answers
3
votes
151k
views
Yoo Help Me On this Please
asked
Mar 7, 2021
Mathematics
high-school
2
answers
0
votes
52.9k
views
Convert 135 Meters to kilometers
asked
Dec 8, 2020
Chemistry
middle-school
1
answer
4
votes
111k
views
Using the additive inverse. What does 12-(-4)=?
asked
Oct 18, 2020
Mathematics
middle-school
1
answer
2
votes
198k
views
What advantages did Britain have against America during the american war for independence?
asked
Sep 16, 2020
History
middle-school
1
answer
4
votes
26.2k
views
Two points A and B lie on opposite sides of a river. Another point C is located on the same side of the river as B at a distance of 240 ft from B. If angle ABC is 100° and angle ACB is 25°, find the distance
asked
Apr 9, 2020
Mathematics
high-school
1
answer
2
votes
140k
views
Can someone please me please
asked
Jan 22, 2020
Mathematics
middle-school
1
answer
0
votes
168k
views
Fill in the blank: An area where a mantle plume forces magma through the crust that is NOT a result of plate boundary interactions is ________. A. Not possible. Magma only comes up at plate boundaries.
asked
Mar 6, 2019
Biology
middle-school
2
answers
4
votes
162k
views
Justin is a 6-month-old infant. he focuses intently on new stimuli, and quickly becomes habituated. what can we infer about justin's cognitive abilities?
asked
Oct 28, 2018
Biology
high-school
1
answer
3
votes
142k
views
Jbx automobiles, a global firm, builds factories to serve more than one country and lower the mne's production costs. jbx automobiles most likely benefits from ________.
asked
Jun 22, 2018
Business
high-school
1
answer
4
votes
192k
views
Do pure substances have the same chemical and physical properties
asked
Nov 23, 2017
Chemistry
middle-school
1
answer
3
votes
153k
views
The Dutch lost the Cape of Good Hope to the _____. British Africans French Boers
asked
Sep 27, 2017
History
high-school
2
answers
1
vote
224k
views
The Joint Photographic Experts Group developed the ___________ graphic format. It is important to include the ____ attribute of the tag because some people use text-only Web browsers. Fill in the blanks
asked
Feb 11, 2017
Computers & Tech
high-school
2
answers
3
votes
44.2k
views
Mr. Lee received a raise at a job this year, but he finds that he has less money to spend each month. What is the most likely reason for this situation? a. The supply of goods and services has risen b.
asked
Nov 13, 2016
Mathematics
high-school
1
answer
2
votes
114k
views
Page:
« prev
1
2
Ask a Question
Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.
Search Qamnty