Recent activity by Hiraku

Recent activity by Hiraku

Calculate the efficiency of 30 000 W of power shipped at 5000 V over 15 Ohms transmission lines.

asked Dec 28, 2024

1 answer 198k views

The boy who harnessed the wind summary

answered Dec 7, 2024

1 answer 211k views

In his book, the Republic, ___ proposed dividing society into three classes.

asked Nov 22, 2024

1 answer 178k views

All of the following are true, EXCEPT: (S12) a German involvement in the Spanish Civil War allowed German weaponry to be tested in battle. b In order to 'appease' Hitler, France and Great Britain betrayed

answered Nov 4, 2024

2 answers 163k views

Choose all of the statements from below which correctly describe issues pertaining to the relationship between the emf of a reaction and its Gibbs free energy change. (A) The Gibbs free energy change and

asked Oct 16, 2024

1 answer 58.2k views

What enables the fledgling to flutter from branch to branch? 1) Developing flight feathers 2) Strong leg muscles 3) Sharp beak 4) Keen eyesight

answered Sep 20, 2024

1 answer 154k views

At what temperature does a solid steel I-beam begin to change form by elongating when involved in a structural fire?

asked Sep 13, 2024

1 answer 142k views

How did the assassination of Archduke lead to ww1?

asked Aug 13, 2024

1 answer 113k views

RATIONAL VS. IRRATIONAL NUMBERS Rational numbers are numbers that can be written as fractions or ________. Rational numbers include: __________ and ____________- Square roots of decimals squares Irrational

asked Jul 18, 2024

1 answer 150k views

___________ ___________ consist of multiple chains. Often the __________ ____________ will have a variety of different types of chains. (Some people may use the term "__________" as a synonym for these.

asked Jun 3, 2024

1 answer 189k views

What is the historical and conceptual background that led to the development of the Schrödinger equation in quantum mechanics, and how does it address the challenges posed by the behavior of electrons

answered Jun 2, 2024

1 answer 90.1k views

Which action should be included in a plan element that is part of a Computer Security Incident Response Capability (CSIRC)? Option 1: Ignoring potential incidents Option 2: Notifying relevant authorities

asked May 18, 2024

1 answer 165k views

A 2-kg box is sliding down an inclined surface. At some point, its speed is 4 m/s. What is its kinetic energy?

asked May 5, 2024

1 answer 99.4k views

A determination of which groups are significantly different from each other cannot be done with the analysis of variance test a. true b. false

asked Apr 21, 2024

1 answer 146k views

A given mass of gas has a pressure of 80N/m² at a temperature of 40°C. if the temperature is reduced to 27°C with the volume remaining constant, the new pressure is A. 46.ON/m² B. 75.ON/m² C. 80.0N/m²

answered Apr 15, 2024

2 answers 167k views

What defines which fields appear in a list and the order of said fields?

asked Mar 28, 2024

1 answer 68.0k views

Write down the pair of integers whose difference is -6

answered Nov 13, 2023

1 answer 130k views

El lugar en el cine donde compras los boletos es la boletería, o la

answered Oct 26, 2023

1 answer 121k views

Which of the following would provide the first codon?mRNA: UUCAAUGCCUCAAGGUUAAAGCGGCGGUUCCCUGGCAUG

answered Sep 28, 2023

1 answer 79.7k views

What equation represents the line shown:

asked Jul 8, 2023

1 answer 96.6k views

Search Qamnty