menu
Qamnty
Questions by Gottox
Login
Register
My account
Edit my Profile
Private messages
My favorites
Questions by Gottox
Ask a Question
Questions
Unanswered
Tags
Ask a Question
Questions by Gottox
Filter
User Gottox
Recent activity
All questions
All answers
One characteristic of the American family that contributes to the way Americans view their political system is the ________.
asked
Aug 2, 2021
Social Studies
high-school
1
answer
0
votes
18.3k
views
– Complétez les phrases suivantes avec le verbe SE LEVER au présent de l’indicatif : Aujourd’hui c’est lundi, je _______________ à 7h30 pour aller au travail. Ma femme ________________ à 8 heures. Mes
asked
Mar 3, 2021
French
college
1
answer
5
votes
94.8k
views
(10a+53a-37) divided by (10a - 7)
asked
Feb 14, 2021
Mathematics
high-school
1
answer
4
votes
486
views
Anyone know how to answer this?
asked
Feb 3, 2021
Health
middle-school
2
answers
5
votes
47.7k
views
In order to determine the effects of a new drug on memory, one group of subjects is given a pill that contains the drug. A second group is given a sugar pill that does not contain the drug. This second
asked
Oct 11, 2020
Health
high-school
1
answer
1
vote
130k
views
What are healthcare employees responsible for
asked
May 10, 2020
Health
middle-school
1
answer
0
votes
98.5k
views
Find the distance between (-4,2) and (10,2).
asked
Feb 24, 2020
Mathematics
middle-school
2
answers
5
votes
146k
views
14 POINTS SUPER EASY Hydrochloric acid (HCl) is created by a chemical reaction between hydrogen (H) and chlorine (Cl). Which substance is the product of this reaction? hydrogen chlorine hydrochloric acid
asked
Dec 12, 2019
Chemistry
high-school
2
answers
4
votes
138k
views
4th grade math. Need help
asked
Sep 11, 2019
Mathematics
middle-school
2
answers
1
vote
62.4k
views
5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand.
asked
Jul 22, 2019
Biology
middle-school
1
answer
5
votes
106k
views
The most famous and respected muslim leader, who create a peace treaty with christians durings teh crusdae was
asked
Jun 25, 2019
History
high-school
1
answer
0
votes
233k
views
In what year is the us determined to have at least 50% spanish spoken
asked
Apr 26, 2018
History
high-school
2
answers
5
votes
136k
views
Why have most attempts at instituting sustainable farming practices failed? a. farmers do not have enough education. b. outsiders have come in and tried to force new practices on farmers. c. sustainable
asked
Jun 14, 2017
Chemistry
high-school
2
answers
1
vote
18.3k
views
Which of the following is the most important step in the process of setting goals? a. brainstorming b. devising a way to achieve the goals c. determining a long list of goals d. measuring progress toward
asked
Apr 10, 2017
Social Studies
high-school
2
answers
3
votes
162k
views
Which type of molecule in the yolk of a chicken egg provides the most energy for a developing chick?
asked
May 8, 2016
English
high-school
1
answer
1
vote
52.0k
views
Page:
« prev
1
2
Ask a Question
Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.
Search Qamnty