Recent activity by Brijesh Singh

Recent activity by Brijesh Singh

Find the value of 7w-3 given that -2w+4=6

answered Dec 1, 2024

2 answers 23.4k views

Which was not a new technology that helped farmers in the west

answered Nov 10, 2024

1 answer 113k views

3. What happens to the amount of water vapor air can hold as the temperature goes up? A) The amount of water vapor goes up as temperature goes up B) The amount of water vapor goes down as temperature goes

asked Oct 21, 2024

1 answer 200k views

Express in the form 1 : n 5 : 10

asked Sep 19, 2024

1 answer 18.2k views

The tough layer of waterproof material that makes up the outermost part of the epidermis is the stratum lucidum? 1) True 2) False

answered Jul 26, 2024

1 answer 91.2k views

Patients with STEMI undergoing reperfusion with fibrinolytic therapy should receive ____ for 48 hours.

answered Mar 30, 2024

1 answer 192k views

Which of the following best describes the concept of double-arcing? 1) an electric arc that simultaneously forms between the electrode and the nozzle as well as the nozzle and the work piece. 2) an electric

asked Mar 26, 2024

1 answer 124k views

An exterior appendage to a building, forming a covered approach or vestibule to a doorway. Options: Option 1: Balcony Option 2: Veranda Option 3: Porch Option 4: Terrace

answered Mar 26, 2024

1 answer 182k views

On a certain hot summer's day, 247 people used the public swimming pool. The daily prices are $1.50 for children and $2.00 for adults. The receipts for admission totaled $401.50. How many children and

asked Mar 24, 2024

1 answer 185k views

A pet food company conducted an experiment to compare five different cat foods. A sample of 30 cats from the population at a local animal shelter was selected. Each cat was then assigned one of the five

asked Mar 22, 2024

1 answer 69.1k views

Nitrates are converted into ____ ___ (which is simply released into the atmosphere) during a process know as ________

answered Mar 16, 2024

1 answer 209k views

PLEASE I AM TIMED Which best describes the offspring of a solid-colored cow (CC) with a spotted cow (SS), assuming the alleles are codominant? All the offspring will have stripes. All the offspring will

answered Feb 29, 2024

2 answers 145k views

Oves Ovas Ovoy va 5. Which of the following verb forms is NOT a conjugation of the verb ir.

answered Feb 25, 2024

1 answer 153k views

Why was Ptolemy's theory of the universe helpful even though it was incorrect? A) It accurately explained the existence of gravity. B) It accurately predicted solar and lunar eclipses. C) It accurately

answered Feb 20, 2024

1 answer 60.2k views

11. How does culture spread? A. Diffusion and Innovation C. Push and Pull Factors B.Emigration and Immigration D. Human and Physical Characteristics

answered Jan 11, 2024

2 answers 73.2k views

Which of the binomials below is a factor of this trinomial? x^2 + 12x + 36A. x+6B. x-4C. x+4D. x-6

answered Dec 21, 2023

1 answer 110k views

Original DNA: TACTTTAATCCCAAATTTACT DNA: TACTTTAATCCCAAGTTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

answered Dec 19, 2023

1 answer 207k views

Find the midpoint of the line segment with the given points.

asked Dec 8, 2023

1 answer 218k views

If $a$ and $b$ are positive integers for which $ab - 6a + 5b = 373$, what is the minimal possible value of $|a - b|$?

answered Oct 27, 2023

1 answer 81.4k views

What’s the answer ?????

asked Oct 27, 2023

1 answer 97.3k views

Search Qamnty