menu
Qamnty
Answers by Bolza
Login
Register
My account
Edit my Profile
Private messages
My favorites
Answers by Bolza
Ask a Question
Questions
Unanswered
Tags
Ask a Question
Answers by Bolza
Filter
User Bolza
Recent activity
All questions
All answers
What are the consequences of coastal pollution?
answered
Aug 16, 2021
Biology
middle-school
6
votes
45.7k
views
What does inherently classist mean
answered
Jul 18, 2021
English
middle-school
4
votes
22.6k
views
Name the five maritime empires that began expanding during the Age of Exploration
answered
Jul 12, 2021
History
middle-school
4
votes
132k
views
A male and a female person are sitting on the bench "I'm a male', says the person with brown hair " I'm a female says the person with black hair. if atleast one of them is lying, who is male and who is
answered
Jul 7, 2021
English
college
2
votes
124k
views
5. In Act II of The Crucible, why does Proctor think that Abigail accuses Elizabeth of witchcraft? IS O A. Abigail wants to get revenge on Proctor for rejecting her. O B. Abigail wants to distract attention
answered
Jun 16, 2021
English
high-school
6
votes
105k
views
Write an EQUATION for the nth term of each arithmetic sequence -1,-0.5,0,0.5,...
answered
Jun 7, 2021
Mathematics
middle-school
3
votes
119k
views
A triangle with vertices at A(20, -30), B(10.-15), and C(5,-20) has been dilated with a center of dilation at the origin. The image of B, point B', has the coordinates (2, -3). What is the scale factor
answered
Mar 14, 2021
Mathematics
middle-school
4
votes
170k
views
In order for a national convention to be called to propose an amendment to the constitution
answered
Mar 7, 2021
Social Studies
high-school
6
votes
10.4k
views
The uncoupler 2,4-dinitrophenol (DNP) was once prescribed as a weight-reducing drug. How could this agent, in principle, serve as a weight-reducing aid? Uncoupling agents are no longer prescribed because
answered
Dec 19, 2020
Chemistry
high-school
0
votes
233k
views
Which function corresponds to the table? x y 0 3 1 1 2 -1 A) y = 3x - 2 B) y = 2x + 3 C) y = -2x + 3 D) y = -3x + 2
answered
Nov 14, 2020
Mathematics
middle-school
4
votes
161k
views
Evaluate: In humans, the small intestine can be over 8 meters (26 feet) long. Why do you think this organ is so long?
answered
Sep 2, 2020
Biology
college
3
votes
195k
views
Compounds A and B react to form compounds C and D according to the equation: aA + bB → cC + dD. Under which conditions will the rate law be given by the equation: rate = k[A]a[B]b? A. The reaction takes
answered
May 17, 2020
Chemistry
high-school
3
votes
147k
views
What is the value of x? A. 18 B. 76 C. 162 D. 180
answered
Apr 25, 2020
Mathematics
middle-school
4
votes
37.6k
views
Who is responsible for the naming of the Americas?
answered
Aug 5, 2019
History
high-school
3
votes
205k
views
Where are bolsa and sancho going to meet billy jo?at the mechanicat crabby's crab shackat the post office
answered
Jul 27, 2019
Spanish
high-school
3
votes
68.4k
views
A stream in mountain are that is carved from bedrock is called a
answered
May 11, 2019
Geography
high-school
1
vote
46.6k
views
El auto de mi padre costó muy poco. Es _____________.
answered
Dec 30, 2018
Spanish
college
7
votes
186k
views
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? where would a probe with the sequence
answered
Aug 12, 2018
Biology
college
6
votes
42.8k
views
What has increased the world’s awareness of the dangers of hazardous materials?
answered
Jul 17, 2018
Social Studies
high-school
3
votes
123k
views
True or False: When you share something on a friend’s Timeline, only that friend can see it.
answered
Jun 4, 2018
Computers & Tech
middle-school
3
votes
48.9k
views
Page:
« prev
1
2
3
next »
Ask a Question
Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.
Search Qamnty