Help I'm confused! This is the beginning sequence of the first exon in the mRNA sequence: AUGAAGCUCUUUUGGUUGCUUUUCACCAUU Give the DNA/genomic sequence it was transcribed fr…

Question

asked Jan 23, 2021 21.5k views

1 Answer

Dan Field · Answer 1 · 2021-01-27T00:15:20+0000

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Step-by-step explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.