Register

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
asked 54.9k views
3 votes
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

asked
User Aryo
by
8.1k points

1 Answer

7 votes

GTTCAAGCTACTGTTCAAGCTACT

answered
User Nilobarp
by
8.1k points
← Prev Question Next Question →

No related questions found

Ask a Question
Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.

Categories

Other Questions

Which of the objects is living or nonliving: Bacteria, virus, moss, you, a lemon seed, the air, bread, lettuce and rocks?
Why aren't all minerals gemstones?
What are three important types of forces
Link Copied!