asked 189k views
1 vote
Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC

A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code.
B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein.
C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein.
D) Both B and C are possible outcomes.

asked
User UrKll
by
8.1k points

1 Answer

1 vote

Answer:

Option A

Step-by-step explanation:

DNA sequence: GTCACCGGTCTATACATAAGC.

If the bases of codon 5 under a mutation of C to T, the outcome would be?

Bases of the sense codon 5 is TAC, since codons of the sense strand is the same as that of the mRNA except with the replacement of uracil in place of thymine. This codon TAC codes for tyrosine.

If a mutation occurs changing C to T, then the bases would be TAT coding also for tyrosine too due to the nature of redundancy of the genetic code. Thus, there would be no change to the protein sequence although a change would occur in the DNA sequence.

Redundancy of the genetic code indicate that more than one codon can code for an amino acid as there are 64 codons and 20 amino acids.

Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.