Write the complementary sequence to following DNA strand: AATTGCGATCGCTCGTACCGG

Question

asked Oct 26, 2021 24.5k views

1 Answer

← Prev Question Next Question →

Ask a Question

MKay · Answer 1 · 2021-10-31T04:46:53+0000

Answer:

TTAACGCTAGCGAGCATGGCC

Step-by-step explanation:

A and T pair together, and G and C are pairs. Whenever you see one of them in the original sequence, you'd just write the other one for the complementary sequence.

Write the complementary sequence to following DNA strand: AATTGCGATCGCTCGTACCGG

Please log in or register to add a comment.

Please log in or register to answer this question.

1 Answer

Please log in or register to add a comment.

No related questions found

Categories

Other Questions