asked 227k views
0 votes
Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 8C. If an RNA duplex oligonucleotide of identical sequence (sub-stituting U for T) is constructed, will its melting temperature be higher or lower?

1 Answer

5 votes

Melting temperature of RNA duplex will be higher

Step-by-step explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
answered
User Tim McClure
by
7.6k points
Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.