Question

Consider the following RNA, transcribed from the complementary DNA. The RNA contains introns and exons. The exons are in uppercase, introns are in lowercase. The underlined AUG is the translation start codon. ACAAACUAGAUGGUACgugacagatacagaguagugaaguagCAGAUAAUAUAUAGGCC After splicing, what will the sequence of the RNA be?

Answer 1

ACAAACUAGAUGGUACCAGAUAAUAUAUAGGCC

Step-by-step explanation:

Splicing is the process of modification of primary transcript and occurs after the process of transcription. During splicing, intervening non-coding nucleotide sequences called introns are removed. The exons are joined together to make a mature mRNA whose nucleotide sequence would code for protein. The introns (in lower case letters) will be removed from the given sequence of primary transcript during splicing.

Primary transcript: ACAAACUAGAUGGUACgugacagatacagaguagugaaguagCAGAUAAUAUAUAGGCC

After splicing: ACAAACUAGAUGGUACCAGAUAAUAUAUAGGCC