asked 89.0k views
4 votes
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

1 Answer

3 votes

Answer:

look at explanation

Step-by-step explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

answered
User Nmkyuppie
by
8.3k points

No related questions found

Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.