asked 219k views
5 votes
Determine the mRNA and amino acid sequence for the below DNA sequence.

Determine the mRNA and amino acid sequence for the below DNA sequence.-example-1

1 Answer

3 votes
AUGAGCCCCGCUAGGUUCUC
answered
User Arimbun
by
8.7k points

No related questions found

Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.