asked 79.7k views
3 votes
Which of the following would provide the first codon?mRNA: UUCAAUGCCUCAAGGUUAAAGCGGCGGUUCCCUGGCAUG

1 Answer

4 votes

Cells decode mRNAs by reading their nucleotides in groups of three, called codons.

-One "start" codon, AUG, marks the beginning of a protein and also encodes the amino acid methionine

UUCAAUGCCUCAAGGUUAAAGCGGCGG

So the first codon would be AUG

answered
User Hiraku
by
8.2k points

No related questions found

Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.