asked 223k views
2 votes
What is the mRNA transcript if the complementary DNA is TCTGAG?

1 Answer

6 votes

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Step-by-step explanation:

answered
User Vidyanand
by
9.0k points

Related questions

asked Mar 4, 2018 69.5k views
AdamZ asked Mar 4, 2018
by AdamZ
8.7k points
1 answer
1 vote
69.5k views
asked Mar 4, 2022 56.2k views
Brooklyn asked Mar 4, 2022
by Brooklyn
7.9k points
1 answer
1 vote
56.2k views
Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.