asked 223k views
22 votes
Pls, I need help with this! Biology Thank you :)

Pls, I need help with this! Biology Thank you :)-example-1

1 Answer

6 votes

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Step-by-step explanation:

answered
User Salar Rastari
by
9.2k points

No related questions found

Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.

Categories