Question

The sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the other strand be?

Answer 1

TAAGCCGATAAATGCTAACGGTA

Step-by-step explanation:

For DNA, the A's and T's get swapped, and the G's and C's get swapped.

A -> T

T -> A

C -> G

G -> C