The complementary sequence to the original DNA strand is 5' - CGCGTTATAAAGAGTTTTATAACGCG - 3'. This is achieved by following the base pair rules of adenine with thymine and guanine with cytosine.
In biology, one of the fundamental principles of DNA is base pairing. DNA is composed of two strands that pair with one another based on specific base pairings. These pairings are always adenine (A) with thymine (T) and guanine (G) with cytosine (C). Therefore, the complementary sequence to the original strand you provided: 5' - GCGCAATATTTCTCAAAATATTGCGC - 3' would be 5' - CGCGTTATAAAGAGTTTTATAACGCG - 3'. You obtain the complementary sequence by replacing each 'A' on the original strand with 'T' on the new strand, each 'T' with 'A', each 'G' with 'C', and each 'C' with 'G'.
Learn more about DNA Base Pairing