asked 205k views
0 votes
Find the complementary strand for the following dna sequence: 5' gcaaaatccgacggatattatgcttat 3'

2 Answers

0 votes
Could u send a picture of the work?
answered
User Frozen
by
8.2k points
0 votes
The complementary strand for the given DNA sequence would be:

3' cgttttaggctgccataatacgaataa 5'
answered
User Sergio Mendez
by
8.5k points

No related questions found

Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.