asked 3.7k views
5 votes
TACAGGATCATTTCGCGAACGGAGCCGAACT
1. Convert this DNA to Pre mRNA, mRNA, and tRNA

1 Answer

2 votes
AUG UCC UAG UAA AGC GCU UGC CUC GGC CUU GA(?) last letter there is gone
answered
User Autobyte
by
8.5k points

No related questions found

Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.