Question

Predictionof nucleic acid structure from its sequence. A part of a sequenced chromosome has the sequence (on one strand) ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG. Which part of this sequence is most likely to take up the Z conformation?

Answer 1

The sequence GCGCGCGTGCGCGCG within the given DNA strand is most likely to take up the Z-DNA conformation, due to the high GC content which is conducive to the formation of this alternate helical form.

Step-by-step explanation:

The question involves predicting the conformation of nucleic acids based on their sequence, which in this case refers to the potential for a DNA sequence to adopt the Z-DNA conformation. Z-DNA is an alternate left-handed helical form of DNA that is stabilized by alternating purine and pyrimidine bases, particularly when they are in a GC repeat sequence or have high salt concentrations.

Since GC pairs form three hydrogen bonds, they are more stable and promote the formation of Z-DNA. In the provided sequence ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG, the regions with a high content of GC pairs, such as GCGCGCGTGCGCGCG, are most likely to take up the Z conformation. This sequence contains repetitive GC sequences that are conducive to the formation of Z-DNA, which is known for its zig-zag phosphate backbone.