asked 190k views
3 votes
What does blastn search for using what query?

a) Blastp?
b) Blastx
c) tblastn?
d) tblastx?

asked
User Vib
by
7.8k points

1 Answer

3 votes

Final answer:

blastn is a search tool used in bioinformatics to compare nucleotide sequences and find similar sequences in a database. It is used to identify similar sequences, determine gene function, and find evolutionary relationships.

Step-by-step explanation:

blastn is a search tool used in the field of bioinformatics to compare nucleotide sequences. It searches for similarities between a query sequence and other nucleotide sequences in a database. This tool is commonly used to identify similar sequences in different organisms, determine the function of a gene, or find evolutionary relationships.

For example, if you input the sequence 'ATGCACACGGAGGGAAAAAAGCCCGGGAGAG' into blastn, it will search for similar sequences in the chosen database, such as the GenBank database, and provide a list of hits that match with the query sequence.

answered
User Florian Rhiem
by
8.8k points