Question

Phylogenetic trees can be alse made with molecular date, like gene sequences. below are four zene sequences. Thece are takon from four differ ent anmal speces that are beleved to kave "cecme thared ancestry": The gene iequencei are from a so called "broben gene" or pscudogene, the evolutionary remmant of a gene, wheh a now nondunchonal in a gves speocs or goup of related spedel. in ths ease, the gene is called Guto spedes in the form of a phylegenethe tree, lut llo you did ler the prevous phy pogenetic bre qaeiben.

1. GGAGCTGAAGGCCATGCTGGAGGCCCACCCCGAGGTGGTGTCCCACTACCTGGTGGGGCTACGCTTCACCTGGAGG H
2. GGAGCTGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCCGGTGGGGGTGCGCTTCACCCAGAGG \
3. GGAGCTGAAGGCCGTGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCTGGTGGGGGTACGCTTCACCTGGAGG \
4. GGAGATGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTAACCGGTGGGGGTGCGCTTCACCCAAGGG ietwted.

Answer 1

Phylogenetic trees can be constructed using molecular data, such as gene sequences. By comparing the sequences, scientists can determine evolutionary relationships and construct a phylogenetic tree. Computational tools are used to analyze and align the sequences and estimate the evolutionary distance between species.

Step-by-step explanation:

Phylogenetic trees can be constructed using molecular data, such as gene sequences. By comparing the gene sequences of different species, scientists can determine their evolutionary relationships and uncover a shared ancestral ancestry. The sequences provided are from a pseudogene and can be used to construct a phylogenetic tree.

To build a phylogenetic tree using molecular data, the gene sequences are compared with existing sequences in databases. Computational tools are used to analyze and align the sequences, determine their similarity, and estimate the evolutionary distance between species. Molecular analysis has revolutionized phylogenetic trees and has helped confirm or rearrange relationships between species.