asked 75.8k views
2 votes
GIve forward and reverse primers for this sequence:

5' atgaaagg atttattgat gatgcaaact actccgttgg 3'

asked
User Laquanda
by
8.8k points

1 Answer

3 votes

Final answer:

The forward and reverse primers for the given sequence are 5' CTTCTTTAATCAACTACTG 3' and 5' CCAACGGAGTAGTTTGCATC 3', respectively.

Step-by-step explanation:

The forward and reverse primers for the given sequence are:

Forward primer: 5' CTTCTTTAATCAACTACTG 3'

Reverse primer: 5' CCAACGGAGTAGTTTGCATC 3'

These primer sequences are complementary and have opposite chain directions to accommodate Watson-Crick pairings. They are also written in the 5' to 3' direction.

answered
User PhilHarvey
by
8.2k points
Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.