asked 154k views
0 votes
Write out the sequence of amino acids that make up the protein from the following mRNA strand

AUGGCUGGAUGGCUCUCGACUUAGAAAUGA

1 Answer

1 vote

Answer:

To determine the sequence of amino acids in a protein from an mRNA strand, we need to use the genetic code. The genetic code is a set of rules that specify which sequence of three nucleotides (codon) in mRNA corresponds to a specific amino acid. Here is the sequence of amino acids corresponding to the given mRNA strand:

AUG - Methionine (start codon)

GCU - Alanine

GGA - Glycine

UGG - Tryptophan

CUC - Leucine

UCG - Serine

ACU - Threonine

UAG - Stop codon

Therefore, the sequence of amino acids that make up the protein from the given mRNA strand is: Methionine-Alanine-Glycine-Tryptophan-Leucine-Serine-Threonine.

Step-by-step explanation:

MAGGSALGMM

answered
User Slava Chernyak
by
8.6k points

No related questions found

Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.