asked 169k views
4 votes
In the following DNA secuence how many units of information (codons) are?ATCGACGTTGCAGCAGTAGTC

1 Answer

6 votes
There are seven codons in this sequence . A codon is made with every three letters .
In the following DNA secuence how many units of information (codons) are?ATCGACGTTGCAGCAGTAGTC-example-1
answered
User ConnorWGarvey
by
9.4k points

Related questions

asked Nov 17, 2022 36.1k views
Milo P asked Nov 17, 2022
by Milo P
8.0k points
1 answer
0 votes
36.1k views
Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.