asked 93.6k views
20 votes
1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:

asked
User Bdimag
by
7.4k points

2 Answers

10 votes
i am so confused is this an actual question or is it just random letters?-
answered
User Garbo
by
8.9k points
9 votes
Answer:
mRNA: UAUGCUUUAGCGCUAGCGCCGCUAAGCC

CODONS: AUG-GAA-AUG

AMINO ACIDS: METHIONINE-LEUCINE


Explanation: hope this helps
answered
User Xlaudius
by
8.6k points
Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.