asked 193k views
2 votes
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the above (Question 2) transcription.

1 Answer

4 votes
3’ tcgccctactcgcgtacaccgcgtattgac 5’ turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
answered
User Ajmartin
by
8.4k points
Welcome to Qamnty — a place to ask, share, and grow together. Join our community and get real answers from real people.

Categories